WormBase Tree Display for Variation: WBVar00277582
expand all nodes | collapse all nodes | view schema
WBVar00277582 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk1703 | |||
Other_name | Y18D10A.1.1:c.1500+460T>G | ||||
HGVSg | CHROMOSOME_I:g.12802035A>C | ||||
Sequence_details | SMap | S_parent | Sequence | Y18D10A | |
Flanking_sequences | AAATTCCAGATTTTTAGACCAAAAACTCTC | AATTTTCACGTTTTCCAAGCTAAAAATCAC | |||
Mapping_target | Y18D10A | ||||
Type_of_mutation | Substitution | A | C | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036970 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00012474 | |||
Transcript | Y18D10A.1.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | Y18D10A.1.1:c.1500+460T>G | ||||
Intron_number | 6/16 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |