WormBase Tree Display for Variation: WBVar00277582

WBVar00277582 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk1703
    Other_name: Y18D10A.1.1:c.1500+460T>G
    HGVSg: CHROMOSOME_I:g.12802035A>C
  Sequence_details: SMap: S_parent: Sequence: Y18D10A
    Flanking_sequences: AAATTCCAGATTTTTAGACCAAAAACTCTC AATTTTCACGTTTTCCAAGCTAAAAATCAC
    Mapping_target: Y18D10A
    Type_of_mutation: Substitution: A C
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036970
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00012474
    Transcript: Y18D10A.1.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: Y18D10A.1.1:c.1500+460T>G
        Intron_number: 6/16
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele