WormBase Tree Display for Variation: WBVar00277647

WBVar00277647 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk1884
    Other_name: Y37D8A.15.1:c.*1G>A
    HGVSg: CHROMOSOME_III:g.12914741G>A
  Sequence_details: SMap: S_parent: Sequence: Y37D8A
    Flanking_sequences: CACGAATACTTGCGTTTCGGACGCAAATAA AAGGGAATATCTACTATCATCGAAGAAACA
    Mapping_target: Y37D8A
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036970
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00001457
    Transcript: Y37D8A.15.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        HGVSc: Y37D8A.15.1:c.*1G>A
        cDNA_position: 435
        Exon_number: 6/6
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele