WormBase Tree Display for Variation: WBVar00277671
expand all nodes | collapse all nodes | view schema
WBVar00277671 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk1442 | |||
Other_name | Y38E10A.6b.1:c.2131C>T | ||||
Y38E10A.6a.1:c.2125C>T | |||||
CE35654:p.Gln709Ter | |||||
CE35655:p.Gln711Ter | |||||
HGVSg | CHROMOSOME_II:g.12590680G>A | ||||
Sequence_details | SMap | S_parent | Sequence | Y38E10A | |
Flanking_sequences | TTGTGTACAAAACATTATCCTGATACTTTT | CCTCTCTTCTTCCGTCATAGCTTCCAACAT | |||
Mapping_target | Y38E10A | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036969 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00012584 | |||
Transcript | Y38E10A.6b.1 | VEP_consequence | stop_gained | ||
VEP_impact | HIGH | ||||
HGVSc | Y38E10A.6b.1:c.2131C>T | ||||
HGVSp | CE35655:p.Gln711Ter | ||||
cDNA_position | 2131 | ||||
CDS_position | 2131 | ||||
Protein_position | 711 | ||||
Exon_number | 12/19 | ||||
Codon_change | Caa/Taa | ||||
Amino_acid_change | Q/* | ||||
Y38E10A.6a.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | Y38E10A.6a.1:c.2125C>T | ||||
HGVSp | CE35654:p.Gln709Ter | ||||
cDNA_position | 2125 | ||||
CDS_position | 2125 | ||||
Protein_position | 709 | ||||
Exon_number | 12/19 | ||||
Codon_change | Caa/Taa | ||||
Amino_acid_change | Q/* | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |