WormBase Tree Display for Variation: WBVar00277675
expand all nodes | collapse all nodes | view schema
WBVar00277675 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk1443 | |||
Other_name | CE21598:p.Gly168Asp | ||||
Y38E10A.18.1:c.503G>A | |||||
HGVSg | CHROMOSOME_II:g.12637502G>A | ||||
Sequence_details | SMap | S_parent | Sequence | Y38E10A | |
Flanking_sequences | GGAATTCTGTGAGAGCCAGGCAGCAGGGTG | CATTGTTATGGTGAGTTGACTTTTAGGCTT | |||
Mapping_target | Y38E10A | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036969 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00012596 | |||
Transcript | Y38E10A.18.1 (12) | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |