WormBase Tree Display for Variation: WBVar00277731

WBVar00277731 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5036
    Other_name (11)
    HGVSg: CHROMOSOME_II:g.228025C>T
  Sequence_details: SMap: S_parent: Sequence: Y43H11AL
    Flanking_sequences: GGAAATCATCATAATTCTCCGATTTGTGAT CTTCGGGTACAAATCCATCCCGCAGACGTC
    Mapping_target: Y43H11AL
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033304
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00021545
    Transcript: Y43H11AL.1a.3 (12)
      Y43H11AL.1c.1 (12)
      Y43H11AL.1d.1 (12)
      Y43H11AL.1b.1 (12)
      Y43H11AL.1a.1 (12)
      Y43H11AL.1a.2 (12)
      Y43H11AL.1a.4 (12)
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele