WormBase Tree Display for Variation: WBVar00277731
expand all nodes | collapse all nodes | view schema
WBVar00277731 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5036 | |||
Other_name (11) | |||||
HGVSg | CHROMOSOME_II:g.228025C>T | ||||
Sequence_details | SMap | S_parent | Sequence | Y43H11AL | |
Flanking_sequences | GGAAATCATCATAATTCTCCGATTTGTGAT | CTTCGGGTACAAATCCATCCCGCAGACGTC | |||
Mapping_target | Y43H11AL | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033304 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00021545 | |||
Transcript | Y43H11AL.1a.3 (12) | ||||
Y43H11AL.1c.1 (12) | |||||
Y43H11AL.1d.1 (12) | |||||
Y43H11AL.1b.1 (12) | |||||
Y43H11AL.1a.1 (12) | |||||
Y43H11AL.1a.2 (12) | |||||
Y43H11AL.1a.4 (12) | |||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |