WormBase Tree Display for Variation: WBVar00277812
expand all nodes | collapse all nodes | view schema
WBVar00277812 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk1811 | |||
Other_name | Y48E1B.2a.1:c.163C>T | ||||
Y48E1B.2b.1:c.-104+1045C>T | |||||
Y48E1B.17.1:c.*156C>T | |||||
CE50294:p.Arg55Trp | |||||
HGVSg | CHROMOSOME_II:g.13539834G>A | ||||
Sequence_details | SMap | S_parent | Sequence | Y48E1B | |
Flanking_sequences | CTGTCGAATATCTAGAAGCACCGGGATCCC | AAGATCCCCCGAATTCAACTGCTCCCGTTC | |||
Mapping_target | Y48E1B | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036970 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00303002 | |||
WBGene00013001 | |||||
Transcript | Y48E1B.17.1 | VEP_consequence | 3_prime_UTR_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | Y48E1B.17.1:c.*156C>T | ||||
cDNA_position | 595 | ||||
Exon_number | 4/4 | ||||
Y48E1B.2b.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | Y48E1B.2b.1:c.-104+1045C>T | ||||
Intron_number | 1/5 | ||||
Y48E1B.2a.1 (12) | |||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |