WormBase Tree Display for Variation: WBVar00277854

WBVar00277854 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5148
    Other_name: Y51A2D.13b.1:c.-90C>T
    HGVSg: CHROMOSOME_V:g.18579696G>A
  Sequence_details: SMap: S_parent: Sequence: Y51A2D
    Flanking_sequences: CAAAAACAATGTTCAAAAATTTTCAAACCA GAAGTTTTGATTTTTAGATATTTTTACATG
    Mapping_target: Y51A2D
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033304
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00013080
    Transcript: Y51A2D.13b.1 VEP_consequence: 5_prime_UTR_variant
        VEP_impact: MODIFIER
        HGVSc: Y51A2D.13b.1:c.-90C>T
        cDNA_position: 89
        Exon_number: 1/9
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele