WormBase Tree Display for Variation: WBVar00277913
expand all nodes | collapse all nodes | view schema
| WBVar00277913 | Evidence | Paper_evidence | WBPaper00036200 | ||
|---|---|---|---|---|---|
| Name | Public_name | gk2384 | |||
| Other_name | Y54G2A.17b.1:c.889+209T>G | ||||
| Y54G2A.17a.2:c.829+209T>G | |||||
| Y54G2A.17a.1:c.829+209T>G | |||||
| Y54G2A.17a.3:c.829+209T>G | |||||
| HGVSg | CHROMOSOME_IV:g.2880500A>C | ||||
| Sequence_details | SMap | S_parent | Sequence | Y54G2A | |
| Flanking_sequences | AAAAAAAAATCGGGTTTTTTCGATTTTTCT | CAGGCGCCTCTCACACGTGTATCGCGTGTG | |||
| Mapping_target | Y54G2A | ||||
| Type_of_mutation | Substitution | A | C | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00037339 | ||||
| Laboratory | VC | ||||
| Person | WBPerson427 | ||||
| Analysis | Million_Mutation_Pilot_Project | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00021882 | |||
| Transcript | Y54G2A.17a.3 | VEP_consequence | intron_variant | ||
| VEP_impact | MODIFIER | ||||
| HGVSc | Y54G2A.17a.3:c.829+209T>G | ||||
| Intron_number | 3/7 | ||||
| Y54G2A.17b.1 | VEP_consequence | intron_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | Y54G2A.17b.1:c.889+209T>G | ||||
| Intron_number | 4/7 | ||||
| Y54G2A.17a.2 | VEP_consequence | intron_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | Y54G2A.17a.2:c.829+209T>G | ||||
| Intron_number | 4/8 | ||||
| Y54G2A.17a.1 | VEP_consequence | intron_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | Y54G2A.17a.1:c.829+209T>G | ||||
| Intron_number | 4/8 | ||||
| Isolation | Mutagen | ENU | |||
| Reference | WBPaper00036200 | ||||
| Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
| Method | KO_consortium_allele |
