WormBase Tree Display for Variation: WBVar00277920
expand all nodes | collapse all nodes | view schema
WBVar00277920 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5284 | |||
Other_name | Y55D5A.11:n.1170T>C | ||||
Y55D5A.5c.1:c.-99+4408T>C | |||||
HGVSg | CHROMOSOME_III:g.3036374A>G | ||||
Sequence_details | SMap | S_parent | Sequence | Y55D5A | |
Flanking_sequences | ATGATGATGATGACGAAGGAGAAAAAGACA | TGATCTTCAATGTCTTAAAATGAACACAGC | |||
Mapping_target | Y55D5A | ||||
Type_of_mutation | Substitution | A | G | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033305 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00000898 | |||
WBGene00219761 | |||||
Transcript | Y55D5A.5c.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | Y55D5A.5c.1:c.-99+4408T>C | ||||
Intron_number | 1/20 | ||||
Y55D5A.11 | VEP_consequence | non_coding_transcript_exon_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | Y55D5A.11:n.1170T>C | ||||
cDNA_position | 1170 | ||||
Exon_number | 1/1 | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |