WormBase Tree Display for Variation: WBVar00277965

WBVar00277965 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk1557
    Other_name: Y59A8B.5:n.977C>T
    HGVSg: CHROMOSOME_V:g.18018484G>A
  Sequence_details: SMap: S_parent: Sequence: Y59A8B
    Flanking_sequences: GGTCGATTATAGAGTGAGGTACACAAGGAA TGCCTGAAAGCTTTCTTATCTGCTAGGAAT
    Mapping_target: Y59A8B
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036969
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00005511
    Pseudogene: Y59A8B.5 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        HGVSc: Y59A8B.5:n.977C>T
        cDNA_position: 977
        Exon_number: 3/4
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele