WormBase Tree Display for Variation: WBVar00277965
expand all nodes | collapse all nodes | view schema
WBVar00277965 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk1557 | |||
Other_name | Y59A8B.5:n.977C>T | ||||
HGVSg | CHROMOSOME_V:g.18018484G>A | ||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | |
Flanking_sequences | GGTCGATTATAGAGTGAGGTACACAAGGAA | TGCCTGAAAGCTTTCTTATCTGCTAGGAAT | |||
Mapping_target | Y59A8B | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036969 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00005511 | |||
Pseudogene | Y59A8B.5 | VEP_consequence | non_coding_transcript_exon_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | Y59A8B.5:n.977C>T | ||||
cDNA_position | 977 | ||||
Exon_number | 3/4 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |