WormBase Tree Display for Variation: WBVar00278010
expand all nodes | collapse all nodes | view schema
WBVar00278010 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5715 | |||
Other_name | JC8.10a.1:c.1538C>T | ||||
JC8.10b.1:c.1556C>T | |||||
CE29050:p.Pro519Leu | |||||
CE28239:p.Pro513Leu | |||||
HGVSg | CHROMOSOME_IV:g.13265944G>A | ||||
Sequence_details | SMap | S_parent | Sequence | Y67H2A | |
Flanking_sequences | ATTTTAATGGATTGAGGTTCGGCGATTTCG | GACTTCGCTCGACAAGCTGCGATACGGCGT | |||
Mapping_target | Y67H2A | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033306 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00006763 | |||
Transcript | JC8.10b.1 (12) | ||||
JC8.10a.1 (12) | |||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |