WormBase Tree Display for Variation: WBVar00278021
expand all nodes | collapse all nodes | view schema
| WBVar00278021 | Evidence | Paper_evidence | WBPaper00036200 | ||
|---|---|---|---|---|---|
| Name | Public_name | ok5431 | |||
| Other_name | Y69H2.17.1:c.306C>T | ||||
| CE44610:p.Ser102= | |||||
| HGVSg | CHROMOSOME_V:g.18686015C>T | ||||
| Sequence_details | SMap | S_parent | Sequence | Y69H2 | |
| Flanking_sequences | TTCTCAATTACTGGAAAATAGCACGGAAAG | TTCAGGTAACCCAGTTATTGCATAATTTCC | |||
| Mapping_target | Y69H2 | ||||
| Type_of_mutation | Substitution | C | T | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00033305 | ||||
| Laboratory | RB | ||||
| Person | WBPerson46 | ||||
| Analysis | Million_Mutation_Pilot_Project | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00077455 | |||
| Transcript | Y69H2.17.1 | VEP_consequence | synonymous_variant | ||
| VEP_impact | LOW | ||||
| HGVSc | Y69H2.17.1:c.306C>T | ||||
| HGVSp | CE44610:p.Ser102= | ||||
| cDNA_position | 429 | ||||
| CDS_position | 306 | ||||
| Protein_position | 102 | ||||
| Exon_number | 4/7 | ||||
| Codon_change | agC/agT | ||||
| Amino_acid_change | S | ||||
| Isolation | Mutagen | ENU | |||
| Reference | WBPaper00036200 | ||||
| Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
| Method | KO_consortium_allele |
