WormBase Tree Display for Variation: WBVar00278036
expand all nodes | collapse all nodes | view schema
WBVar00278036 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2222 | |||
Sequence_details | SMap | S_parent | Sequence | Y70G10A | |
Flanking_sequences | ACTGAGAATTATGGAGAATATGGAAATTCA | ATGTGCACTGGTTTTCAAAATGTTTTAAAC | |||
Mapping_target | Y70G10A | ||||
Type_of_mutation | Substitution | A | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037288 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Isolation | Mutagen | UV/TMP | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |