WormBase Tree Display for Variation: WBVar00278051
expand all nodes | collapse all nodes | view schema
WBVar00278051 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5199 | |||
Other_name | Y71F9B.10a.1:c.407C>T | ||||
Y71F9B.10b.1:c.407C>T | |||||
CE53802:p.Ala136Val | |||||
Y71F9B.10c.1:c.407C>T | |||||
CE28808:p.Ala136Val | |||||
CE53858:p.Ala136Val | |||||
Y71F9B.10g.1:c.407C>T | |||||
CE50044:p.Ala136Val | |||||
HGVSg | CHROMOSOME_I:g.2775520G>A | ||||
Sequence_details | SMap | S_parent | Sequence | Y71F9B | |
Flanking_sequences | CCATTTTTCATTAGAGCTAGAGCTCCTGGA | CATCAGTGAGCGGTTGACCGAAATAACCGA | |||
Mapping_target | Y71F9B | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033305 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00004946 | |||
Transcript | Y71F9B.10g.1 (12) | ||||
Y71F9B.10c.1 (12) | |||||
Y71F9B.10b.1 (12) | |||||
Y71F9B.10a.1 (12) | |||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |