WormBase Tree Display for Variation: WBVar00278060
expand all nodes | collapse all nodes | view schema
WBVar00278060 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5498 | |||
Other_name | Y71G12B.11a.1:c.*349G>A | ||||
Y71G12B.11b.1:c.*5316G>A | |||||
HGVSg | CHROMOSOME_I:g.1740621G>A | ||||
Sequence_details | SMap | S_parent | Sequence | Y71G12B | |
Flanking_sequences | ATTTATATCGATTATTTTCCGCCTCACCCC | CTCTGTTCTGTTATTTATGTAATATTTTAT | |||
Mapping_target | Y71G12B | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033306 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00006771 | |||
Transcript | Y71G12B.11a.1 | VEP_consequence | 3_prime_UTR_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | Y71G12B.11a.1:c.*349G>A | ||||
cDNA_position | 8016 | ||||
Exon_number | 12/12 | ||||
Y71G12B.11b.1 | VEP_consequence | 3_prime_UTR_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | Y71G12B.11b.1:c.*5316G>A | ||||
cDNA_position | 8314 | ||||
Exon_number | 13/13 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |