WormBase Tree Display for Variation: WBVar00278101

WBVar00278101 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5820
    Other_name: Y75B12B.6.1:c.851G>A
      CE20375:p.Trp284Ter
    HGVSg: CHROMOSOME_V:g.15195307G>A
  Sequence_details: SMap: S_parent: Sequence: Y75B12B
    Flanking_sequences: CCGCAATTTCACCTCAAATGTTCACACATT GATGGTGTCCGATGAGTGCGGAGTTGCGAT
    Mapping_target: Y75B12B
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033306
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00004037
    Transcript: Y75B12B.6.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y75B12B.6.1:c.851G>A
        HGVSp: CE20375:p.Trp284Ter
        cDNA_position: 1002
        CDS_position: 851
        Protein_position: 284
        Exon_number: 9/16
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele