WormBase Tree Display for Variation: WBVar00278183
expand all nodes | collapse all nodes | view schema
WBVar00278183 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5757 | |||
Other_name | CE44503:p.Pro380Ser | ||||
Y97E10B.10.1:c.1138C>T | |||||
HGVSg | CHROMOSOME_V:g.7938613G>A | ||||
Sequence_details | SMap | S_parent | Sequence | Y97E10B | |
Flanking_sequences | TTTTCAATACAGTTAACGATTATTACTCGG | ATCTTTTTTATTATTATTATTATAGTTATT | |||
Mapping_target | Y97E10B | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033306 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00022409 | |||
Transcript | Y97E10B.10.1 | VEP_consequence | missense_variant | ||
VEP_impact | MODERATE | ||||
HGVSc | Y97E10B.10.1:c.1138C>T | ||||
HGVSp | CE44503:p.Pro380Ser | ||||
cDNA_position | 1154 | ||||
CDS_position | 1138 | ||||
Protein_position | 380 | ||||
Exon_number | 7/7 | ||||
Codon_change | Ccc/Tcc | ||||
Amino_acid_change | P/S | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |