WormBase Tree Display for Variation: WBVar00278187

WBVar00278187 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2984
    Other_name: ZC132.11.1:c.789+23A>T
    HGVSg: CHROMOSOME_V:g.4296923T>A
  Sequence_details: SMap: S_parent: Sequence: ZC132
    Flanking_sequences: GATGATCTGAATGAGAAAAAAGTTGAAATT AAAAAGTTAAGAAAGAACTTACAATCTCAT
    Mapping_target: ZC132
    Type_of_mutation: Substitution: T A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005866
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00269432
    Transcript: ZC132.11.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: ZC132.11.1:c.789+23A>T
        Intron_number: 5/6
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele