WormBase Tree Display for Variation: WBVar00278191
expand all nodes | collapse all nodes | view schema
WBVar00278191 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2676 | |||
Other_name | CE41741:p.Asp46Asn | ||||
ZC15.7.1:c.136G>A | |||||
HGVSg | CHROMOSOME_V:g.20288827C>T | ||||
Sequence_details | SMap | S_parent | Sequence | ZC15 | |
Flanking_sequences | CCGCGTGAAAAAGAACGTTTCTTCCCTTGT | ATCTAGAATTTCCCAAAAATGGTCAACATC | |||
Mapping_target | ZC15 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037340 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00013835 | |||
Transcript | ZC15.7.1 (12) | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |