WormBase Tree Display for Variation: WBVar00278223
expand all nodes | collapse all nodes | view schema
WBVar00278223 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5141 | |||
Other_name | CE34137:p.Gln255His | ||||
ZK1037.10.1:c.765A>C | |||||
HGVSg | CHROMOSOME_V:g.15336003T>G | ||||
Sequence_details | SMap | S_parent | Sequence | ZK1037 | |
Flanking_sequences | GTAGATTTTGGAAAAAAATACCGCTGGCTG | TGAGCAACCGCCGGATACACGTTGTACTGC | |||
Mapping_target | ZK1037 | ||||
Type_of_mutation | Substitution | T | G | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033304 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00006953 | |||
Transcript | ZK1037.10.1 (12) | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |