WormBase Tree Display for Variation: WBVar00278225
expand all nodes | collapse all nodes | view schema
WBVar00278225 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | ok5751 | |||
Other_name | ZK1055.4.1:c.-26C>T | ||||
ZK1055.4.2:c.-2-24C>T | |||||
HGVSg | CHROMOSOME_V:g.6585606C>T | ||||
Sequence_details | SMap | S_parent | Sequence | ZK1055 | |
Flanking_sequences | ATTCAACCTATACTGTTTGAAGAATGGAAT | TAATAATGAAGAATGTTGGTTCAGAATGTT | |||
Mapping_target | ZK1055 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033306 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00022845 | |||
Transcript | ZK1055.4.2 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | ZK1055.4.2:c.-2-24C>T | ||||
Intron_number | 1/8 | ||||
ZK1055.4.1 | VEP_consequence | 5_prime_UTR_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZK1055.4.1:c.-26C>T | ||||
cDNA_position | 2329 | ||||
Exon_number | 9/16 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |