WormBase Tree Display for Variation: WBVar00278231

WBVar00278231 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk952
    Other_name: ZK1098.3.1:c.1091C>A
      CE01108:p.Ser364Ter
    HGVSg: CHROMOSOME_III:g.9536742G>T
  Sequence_details: SMap: S_parent: Sequence: ZK1098
    Flanking_sequences: GGCATATATTTTGAATTACGGTCGATATTC AATAAGTTGCCCAGAACAATGCTTCAATTC
    Mapping_target: ZK1098
    Type_of_mutation: Substitution: G T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036970
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00014220
    Transcript: ZK1098.3.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK1098.3.1:c.1091C>A
        HGVSp: CE01108:p.Ser364Ter
        cDNA_position: 1098
        CDS_position: 1091
        Protein_position: 364
        Exon_number: 4/8
        Codon_change: tCg/tAg
        Amino_acid_change: S/*
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Allele confirmed by Sanger sequencing
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele