WormBase Tree Display for Variation: WBVar00278239

WBVar00278239 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5243
  Sequence_details: Flanking_sequences: TAGATATCTTTGAACTACTCATAGAAATGTAAATAACATTTTATCACTTT GGAATATATTTCTTTTTCAACAAAATACACATGAATATTTATAACTAAAA
    Mapping_target: ZK1248
    Type_of_mutation: Substitution: G T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033305
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Dead
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    This was suppressed because it overlapped with a corrected genome sequence error feature Feature_evidence: WBsf268592
    This was un-suppressed after examination showed it is not changed by the corrected genome sequence error Curator_confirmed: WBPerson4025
    (Re)suppressed because on closer inspection is made invalid by a genome sequence correction Feature_evidence: WBsf268592
    [Suppressed] This gene was previously annotaed as supressed.
  Method: KO_consortium_allele