WormBase Tree Display for Variation: WBVar00278313

WBVar00278313 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2764
    Other_name: ZK973.9.1:c.409C>T
      CE23479:p.Gln137Ter
    HGVSg: CHROMOSOME_I:g.4371100G>A
  Sequence_details: SMap: S_parent: Sequence: ZK973
    Flanking_sequences: TTGGCGGAGGAGCAAATCCGTGAGGCGGCT CATTGGACCACCTGGACTTGGTGCCGCCTG
    Mapping_target: ZK973
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005866
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00022835
    Transcript: ZK973.9.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: ZK973.9.1:c.409C>T
        HGVSp: CE23479:p.Gln137Ter
        cDNA_position: 436
        CDS_position: 409
        Protein_position: 137
        Exon_number: 3/5
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele