WormBase Tree Display for Variation: WBVar00278345
expand all nodes | collapse all nodes | view schema
WBVar00278345 | Name | Public_name | gk1064 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_X:g.13262195_13263004delinsCTTATTTC | ||||
Sequence_details | SMap | S_parent | Sequence | K09A11 | |
Flanking_sequences | tttgttctccactctttattcgtattgaat | gtacgaagaccaactaagaatggaattgaa | |||
Mapping_target | K09A11 | ||||
Type_of_mutation | Insertion | CTTATTTC | |||
Deletion | |||||
PCR_product | GK1064_external | ||||
GK1064_internal | |||||
SeqStatus | Sequenced | ||||
Deletion_verification | Passed by CGH 2009-09-04, with low log2 scores | Person_evidence | WBPerson154 | ||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037028 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00010704 | |||
WBGene00172520 | |||||
Transcript | K09A11.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | ?-460 | ||||
CDS_position | ?-455 | ||||
Protein_position | ?-152 | ||||
Intron_number | 2/6 | ||||
Exon_number | 1-3/7 | ||||
K09A11.7 | |||||
Isolation | Mutagen | UV/TMP | |||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
Method | KO_consortium_allele |