WormBase Tree Display for Variation: WBVar00278478
expand all nodes | collapse all nodes | view schema
WBVar00278478 | Evidence | Paper_evidence | WBPaper00033045 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | gv560 | |||||||
Other_name | F45B8.4.1:c.668C>T | ||||||||
CE24977:p.Ser223Phe | |||||||||
HGVSg | CHROMOSOME_X:g.14951767G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F45B8 | |||||
Flanking_sequences | ctgtatgtggaaaagcgttcagtcagtctt | taaccttatcacccacacacgaaaacacac | |||||||
Mapping_target | F45B8 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00033045 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | KM | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003909 | |||||||
Transcript | F45B8.4.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F45B8.4.1:c.668C>T | ||||||||
HGVSp | CE24977:p.Ser223Phe | ||||||||
cDNA_position | 795 | ||||||||
CDS_position | 668 | ||||||||
Protein_position | 223 | ||||||||
Exon_number | 8/12 | ||||||||
Codon_change | tCt/tTt | ||||||||
Amino_acid_change | S/F | ||||||||
Interactor | WBInteraction000503955 | ||||||||
Genetics | Interpolated_map_position | X | 21.5907 | ||||||
Description | Phenotype | WBPhenotype:0000643 | Paper_evidence | WBPaper00033045 | |||||
Curator_confirmed | WBPerson2238 | ||||||||
Remark | A reverse kinker uncoordinated phenotype | Paper_evidence | WBPaper00033045 | ||||||
Curator_confirmed | WBPerson2238 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00033045 | |||||||
Curator_confirmed | WBPerson2238 | ||||||||
Remark | Increased expression levels of IDA-1::GFP in a subset of neurons (such as VC4, VC5 and ALA, et al.) | Paper_evidence | WBPaper00033045 | ||||||
Curator_confirmed | WBPerson2238 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004617 | PATO:0000460 | Paper_evidence | WBPaper00033045 | ||||
Curator_confirmed | WBPerson2238 | ||||||||
WBbt:0004613 | PATO:0000460 | Paper_evidence | WBPaper00033045 | ||||||
Curator_confirmed | WBPerson2238 | ||||||||
WBbt:0003955 | PATO:0000460 | Paper_evidence | WBPaper00033045 | ||||||
Curator_confirmed | WBPerson2238 | ||||||||
Phenotype_assay | Genotype | IDA-1::GFP | Paper_evidence | WBPaper00033045 | |||||
Curator_confirmed | WBPerson2238 | ||||||||
Reference | WBPaper00033045 | ||||||||
Method | Substitution_allele |