WormBase Tree Display for Variation: WBVar00278525
expand all nodes | collapse all nodes | view schema
WBVar00278525 | Evidence | Paper_evidence | WBPaper00036485 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ky602 | |||||||
Other_name | C39F7.2b.1:c.1291C>T | ||||||||
C39F7.2a.1:c.1291C>T | |||||||||
CE42345:p.Gln431Ter | |||||||||
CE27581:p.Gln431Ter | |||||||||
HGVSg | CHROMOSOME_V:g.1227354G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C39F7 | |||||
Flanking_sequences | ctgaaggagccagatccgacggtgtatatg | aggtatgtcctgggaaacattgcaaactct | |||||||
Mapping_target | C39F7 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00016539 | |||||||
Transcript | C39F7.2a.1 | VEP_consequence | stop_gained,splice_region_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C39F7.2a.1:c.1291C>T | ||||||||
HGVSp | CE27581:p.Gln431Ter | ||||||||
cDNA_position | 1302 | ||||||||
CDS_position | 1291 | ||||||||
Protein_position | 431 | ||||||||
Exon_number | 7/15 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
C39F7.2b.1 | VEP_consequence | stop_gained,splice_region_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C39F7.2b.1:c.1291C>T | ||||||||
HGVSp | CE42345:p.Gln431Ter | ||||||||
cDNA_position | 1312 | ||||||||
CDS_position | 1291 | ||||||||
Protein_position | 431 | ||||||||
Exon_number | 7/14 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000504443 | ||||||||
Genetics | Interpolated_map_position | V | -19.8477 | ||||||
Description | Phenotype | WBPhenotype:0000384 | Paper_evidence | WBPaper00036484 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The primary axon of ADL grows into the nerve ring ventrally rather than laterally. This phenotype occurs at a lower frequency than the axon branching phenotype. AVM axons fail to grow ventrally. HSN motor neurons fail to polarize properly. Axon guidance that relies on repulsive cues occur normally. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00036484 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ADL projects a normal dorsal branch but no ventral branch. This phenotype is also observed in L1 animals. Ventrally extended branches of PLM were either missing or shorter than normal. AVM branching was also defective with about half of the animals showing severely shortened or no branches. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00036484 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | MIG-10::GFP was significantly mislocalized and dispersed around the periphery in HSN. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002491 | Paper_evidence | WBPaper00036484 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | HSN neurons in mutants extend neurites in all directions. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | WNT signaling-based PLM polarity is normal. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00036484 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | WNT signaling-based HSN cell migration is normal. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000883 | Paper_evidence | WBPaper00036484 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Nerve ring was located correctly in these animals. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006749 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00036484 | ||||||||
WBPaper00036485 | |||||||||
Method | Substitution_allele |