WormBase Tree Display for Variation: WBVar00296349

WBVar00296349 Name: Public_name: tm4739
    Other_name: C17E4.6.1:c.384+23_818del
    HGVSg: CHROMOSOME_I:g.9423065_9423663del
  Sequence_details: SMap: S_parent: Sequence: C17E4
    Flanking_sequences: ttgaagaggtaaacaaatttaatgttttat tactctgtctgaaataaaggttagtttatt
    Mapping_target: C17E4
    Source_location: 7 CHROMOSOME_I 9423064 9423664 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4739_external
      tm4739_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4739
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007645
    Transcript: C17E4.6.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C17E4.6.1:c.384+23_818del
        cDNA_position: ?-828
        CDS_position: ?-818
        Protein_position: ?-273
        Intron_number: 4-5/8
        Exon_number: 5-6/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 18069/18070-18668/18669 (599 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele