WormBase Tree Display for Variation: WBVar00296409

WBVar00296409 Name: Public_name: tm4822
    Other_name: Y105E8A.20b.1:c.97_196-19del
    HGVSg: CHROMOSOME_I:g.14495087_14495229del
  Sequence_details: SMap: S_parent: Sequence: Y105E8A
    Flanking_sequences: tgcttggaaaatctgaaaattttgattttt gtaggcatggccgatgtggggctctggaat
    Mapping_target: Y105E8A
    Source_location: 7 CHROMOSOME_I 14495086 14495230 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4822_external
      tm4822_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4822
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00013678
    Transcript: Y105E8A.20b.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y105E8A.20b.1:c.97_196-19del
        cDNA_position: 155-?
        CDS_position: 97-?
        Protein_position: 33-?
        Intron_number: 3/10
        Exon_number: 3/11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 161926/161927-162069/162070 (143 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele