WormBase Tree Display for Variation: WBVar00296417

WBVar00296417 Name: Public_name: tm4843
    Other_name: Y119C1B.4.1:c.200_582del
      CE27233:p.Leu68SerfsTer21
    HGVSg: CHROMOSOME_I:g.4510375_4510866del
  Sequence_details: SMap: S_parent: Sequence: Y119C1B
    Flanking_sequences: cttgttttttctctttaaaatccttacttt cctctttcagcgcattccgacgattccaga
    Mapping_target: Y119C1B
    Source_location: 7 CHROMOSOME_I 4510374 4510867 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4843_external
      tm4843_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4843
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022470
    Transcript: Y119C1B.4.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 7288/7289-7780/7781 (492 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele