WormBase Tree Display for Variation: WBVar00296552
expand all nodes | collapse all nodes | view schema
WBVar00296552 | Evidence | Paper_evidence | WBPaper00036408 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ju587 | |||||||
Other_name | F26H9.7a.1:c.757-1G>A | ||||||||
F26H9.7b.1:c.643-1G>A | |||||||||
HGVSg | CHROMOSOME_I:g.9312203G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F26H9 | |||||
Flanking_sequences | gaaaacatttaaattttttgcaattattca | tgggacatgcgtggaattcaatgggaacga | |||||||
Mapping_target | F26H9 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00036408 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CZ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006732 | |||||||
Transcript | F26H9.7b.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F26H9.7b.1:c.643-1G>A | ||||||||
Intron_number | 6/8 | ||||||||
F26H9.7a.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F26H9.7a.1:c.757-1G>A | ||||||||
Intron_number | 6/8 | ||||||||
Interactor | WBInteraction000517531 | ||||||||
Genetics | Interpolated_map_position | I | 3.73927 | ||||||
Description | Phenotype | WBPhenotype:0000181 | Paper_evidence | WBPaper00036408 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Low levels of ALM and PLM defects are detected | Paper_evidence | WBPaper00036408 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00036408 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00036408 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000604 | Paper_evidence | WBPaper00036408 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The uev-3 mutants alone also develop normally and exhibit no discernable abnormalities in the motor and mechanosensory neurons. | Paper_evidence | WBPaper00036408 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00036408 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The uev-3 mutants alone also develop normally and exhibit no discernable abnormalities in the motor and mechanosensory neurons. | Paper_evidence | WBPaper00036408 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00036408 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | SNB-1::GFP puncta patterns are similar to wild type. | Paper_evidence | WBPaper00036408 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00036408 | ||||||||
Method | Substitution_allele |