WormBase Tree Display for Variation: WBVar00296617
expand all nodes | collapse all nodes | view schema
WBVar00296617 | Evidence | Paper_evidence | WBPaper00061133 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok2679 | ||||||
Other_name | CE29161:p.Thr263SerfsTer31 | |||||||
CE50793:p.Thr110SerfsTer? | ||||||||
ZK6.10b.1:c.326_714del | ||||||||
ZK6.10a.1:c.785_1173del | ||||||||
HGVSg | CHROMOSOME_V:g.411962_412720del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK6 | ||||
Flanking_sequences | cgaaattgtaacggacacaaataattgaac | tagaaactgtgcccatgggcttcatataga | ||||||
Mapping_target | ZK6 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok2679_external | |||||||
ok2679_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00037201 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00022644 | ||||||
Transcript | ZK6.10c.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-126 | |||||||
CDS_position | ?-126 | |||||||
Protein_position | ?-42 | |||||||
Exon_number | 1/1 | |||||||
ZK6.10b.1 (11) | ||||||||
ZK6.10a.1 (11) | ||||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0001171 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
Remark | shortened lifespan upon exposure to S. maltophilia JCMS | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Remark | NO lifespan phenotype upon exposure to E. coli OP50 | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
Reference | WBPaper00061133 | |||||||
WBPaper00059839 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |