WormBase Tree Display for Variation: WBVar00296632
expand all nodes | collapse all nodes | view schema
WBVar00296632 | Name | Public_name | ok3447 | ||
---|---|---|---|---|---|
Other_name | ZK945.2.1:c.562_*218delinsAAAAAAAAAAAAAA | ||||
HGVSg | CHROMOSOME_II:g.10098789_10099198delinsTTTTTTTTTTTTTT | ||||
Sequence_details | SMap | S_parent | Sequence | ZK945 | |
Flanking_sequences | gaattgtgcataaacatgtttctggtttgt | attcacatccagctcctcgatcttcagctt | |||
Mapping_target | ZK945 | ||||
Type_of_mutation | Insertion | TTTTTTTTTTTTTT | |||
Deletion | |||||
PCR_product | ok3447_external | ||||
ok3447_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037538 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00003928 | |||
Transcript | ZK945.2.1 | VEP_consequence | stop_lost,3_prime_UTR_variant | ||
VEP_impact | HIGH | ||||
HGVSc | ZK945.2.1:c.562_*218delinsAAAAAAAAAAAAAA | ||||
cDNA_position | 563-972 | ||||
CDS_position | 562-? | ||||
Protein_position | 188-? | ||||
Exon_number | 4-5/5 | ||||
Isolation | Mutagen | EMS | |||
Remark | Sequence of insertion uncertain due to poor sequence quality after the breakpoint, should be confirmed. | ||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |