WormBase Tree Display for Variation: WBVar00296645
expand all nodes | collapse all nodes | view schema
WBVar00296645 | Name | Public_name | ok3692 | ||||
---|---|---|---|---|---|---|---|
Other_name (16) | |||||||
HGVSg | CHROMOSOME_V:g.13173799_13174455del | ||||||
Sequence_details | SMap | S_parent | Sequence | T09E8 | |||
Flanking_sequences | aacttgaactgacacaaaaagaacagagct | gaatttgagagaatgcgatcagagaaagga | |||||
Mapping_target | T09E8 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok3692_external | ||||||
ok3692_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00037614 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00011647 | |||||
Transcript | T09E8.1d.1 (11) | ||||||
T09E8.1c.1 (11) | |||||||
T09E8.1a.1 (11) | |||||||
T09E8.1g.1 (11) | |||||||
T09E8.1e.1 (11) | |||||||
T09E8.1h.1 (11) | |||||||
T09E8.1f.1 (11) | |||||||
T09E8.1b.1 (11) | |||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype | WBPhenotype:0000036 | Paper_evidence | WBPaper00048540 | |||
Curator_confirmed | WBPerson12586 | ||||||
Remark | At 72-hour after bleach synchronization and release, worms that are homozygous for both lt1 and ok3692 have a body length that is only ~50% of wild type or single mutant controls. | Paper_evidence | WBPaper00048540 | ||||
Curator_confirmed | WBPerson12586 | ||||||
WBPhenotype:0000058 | Paper_evidence | WBPaper00048540 | |||||
Curator_confirmed | WBPerson12586 | ||||||
Remark | Worms that are homozygous for both lt1 and ok3692 rupture and die starting from L4 stage. ~15% of worms die at L4 stage after L1 release from bleach synchronization. | Paper_evidence | WBPaper00048540 | ||||
Curator_confirmed | WBPerson12586 | ||||||
WBPhenotype:0000060 | Paper_evidence | WBPaper00048540 | |||||
Curator_confirmed | WBPerson12586 | ||||||
Remark | About 60% of worms that are homozygous for both lt1 and ok3692 rupture and die at 72-hour after L1 release from bleach synchronization. This is the 1st day adult. | Paper_evidence | WBPaper00048540 | ||||
Curator_confirmed | WBPerson12586 | ||||||
WBPhenotype:0000685 | Paper_evidence | WBPaper00048540 | |||||
Curator_confirmed | WBPerson12586 | ||||||
Remark | Worms that are homozygous for both lt1 and ok3692 grow slower than wild type or single mutant controls. At the L4 stage, their body length are only about 2/3 of wild type or single mutant controls. | Paper_evidence | WBPaper00048540 | ||||
Curator_confirmed | WBPerson12586 | ||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00048540 | |||||
Curator_confirmed | WBPerson12586 | ||||||
Remark | Homozygous ok3692 worms grew up to be normal size adults that are completely sterile. ok3692 allele is balanced by nT1[qIs51], but its locus is ~2 cM outside of the translocation junction. Thus, recombination could happen at a low frequency. It is thus important to maintain the allele by frequently singling out non-sterile carrying the green pharynx marker and verify correct segregation. Note that the original ok3692 allele from CGC is linked with a daf-c mutation. Please contact the Oegema lab to obtain the outcrossed allele. | Paper_evidence | WBPaper00048540 | ||||
Curator_confirmed | WBPerson12586 | ||||||
Reference | WBPaper00048540 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |