WormBase Tree Display for Variation: WBVar00296682

WBVar00296682 Name: Public_name: tm4875
    Other_name: Y49F6B.2.1:c.111+40_270del
    HGVSg: CHROMOSOME_II:g.3503124_3503331del
  Sequence_details: SMap: S_parent: Sequence: Y49F6B
    Flanking_sequences: aaaaacggcgatttttgcaaatttttagcg gttgtcgggccgaagtttgaaggcgatcat
    Mapping_target: Y49F6B
    Source_location: 7 CHROMOSOME_II 3503123 3503332 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4875_external
      tm4875_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4875
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00021715
    Transcript: Y49F6B.2.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y49F6B.2.1:c.111+40_270del
        cDNA_position: ?-276
        CDS_position: ?-270
        Protein_position: ?-90
        Intron_number: 2/6
        Exon_number: 3/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 37324/37325-37532/37533 (208 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele