WormBase Tree Display for Variation: WBVar00296713

WBVar00296713 Name: Public_name: tm4967
    Other_name: K12B6.2b.1:c.49_326-15del
      K12B6.2a.1:c.49_326-15del
    HGVSg: CHROMOSOME_V:g.6281470_6281869del
  Sequence_details: SMap: S_parent: Sequence: K12B6
    Flanking_sequences: aaaaaacgggatgaagttcgaagacgagaa taacttatttctagatccgttcactatgtt
    Mapping_target: K12B6
    Source_location: 7 CHROMOSOME_V 6281469 6281870 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4967_external
      tm4967_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4967
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019667
    Transcript: K12B6.2a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: K12B6.2a.1:c.49_326-15del
        cDNA_position: 112-?
        CDS_position: 49-?
        Protein_position: 17-?
        Intron_number: 2-4/18
        Exon_number: 2-4/19
      K12B6.2b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: K12B6.2b.1:c.49_326-15del
        cDNA_position: 55-?
        CDS_position: 49-?
        Protein_position: 17-?
        Intron_number: 2-4/18
        Exon_number: 2-4/19
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000692 Paper_evidence: WBPaper00054272
        Curator_confirmed: WBPerson2191
        Remark: Sterile hermaphrodites and males due to a sperm defect. Sperm appear normal and male sperm can engage in sperm competition. Can be rescued by wild type sperm. Paper_evidence: WBPaper00054272
            Curator_confirmed: WBPerson2191
      WBPhenotype:0001360 Paper_evidence: WBPaper00054272
        Curator_confirmed: WBPerson2191
        Remark: Sterile hermaphrodites and males due to a sperm defect. Sperm appear normal and male sperm can engage in sperm competition. Can be rescued by wild type sperm. Paper_evidence: WBPaper00054272
            Curator_confirmed: WBPerson2191
  Reference: WBPaper00054272
  Remark: 3901/3902-4301/4302 (400 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele