WormBase Tree Display for Variation: WBVar00296715

WBVar00296715 Name: Public_name: tm4930
    Other_name: C43E11.10.1:c.291_779del
      CE08688:p.Leu98_Ter260delextTer?
    HGVSg: CHROMOSOME_I:g.4269342_4269877del
  Sequence_details: SMap: S_parent: Sequence: C43E11
    Flanking_sequences: accagaggagttttgaattgcttcacgtgc gatgatccgggactcagaagcaattttcgt
    Mapping_target: C43E11
    Source_location: 7 CHROMOSOME_I 4269341 4269878 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4930_external
      tm4930_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4930
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000382
    Transcript: C43E11.10.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 40338/40339-40874/40875 (536 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele