WormBase Tree Display for Variation: WBVar00296778
expand all nodes | collapse all nodes | view schema
WBVar00296778 | Evidence | Paper_evidence | WBPaper00037686 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e2977 | |||||
Other_name | CE39741:p.Gln112Ter | ||||||
JC8.12b.1:c.334C>T | |||||||
CE29812:p.Gln123Ter | |||||||
JC8.12a.1:c.367C>T | |||||||
HGVSg | CHROMOSOME_IV:g.13257276C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | JC8 | |||
Flanking_sequences | ctagtcggtctagctgccagaaatagacaa | agagagtagatcagaataaaacctttataa | |||||
Mapping_target | JC8 | ||||||
Type_of_mutation | Substitution | c | t | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004703 | ||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00010442 | |||||
Transcript | JC8.12a.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | JC8.12a.1:c.367C>T | ||||||
HGVSp | CE29812:p.Gln123Ter | ||||||
cDNA_position | 367 | ||||||
CDS_position | 367 | ||||||
Protein_position | 123 | ||||||
Exon_number | 3/9 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
JC8.12b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | JC8.12b.1:c.334C>T | ||||||
HGVSp | CE39741:p.Gln112Ter | ||||||
cDNA_position | 334 | ||||||
CDS_position | 334 | ||||||
Protein_position | 112 | ||||||
Exon_number | 2/8 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
Genetics | Interpolated_map_position | IV | 8.50462 | ||||
Description | Phenotype | WBPhenotype:0001012 | Paper_evidence | WBPaper00037686 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals are able to even less efficiently across bands of CBX120 (Bacillus pumilus) bacteria growth (hurdles) than wild type animals; almost all animals remain stuck at the first of three hurdles, while wild type worms can move through these bands, even through it is with great difficulty. | Paper_evidence | WBPaper00037686 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001209 | Paper_evidence | WBPaper00037686 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals exhibit only a minor aspect of skiddy. | Paper_evidence | WBPaper00037686 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001413 | Paper_evidence | WBPaper00037686 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The Bus phenotype is more similar to br5 than to e2740. | Paper_evidence | WBPaper00037686 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002159 | Paper_evidence | WBPaper00045395 | |||||
Curator_confirmed | WBPerson499 | ||||||
WBPhenotype:0002354 | Paper_evidence | WBPaper00045395 | |||||
Curator_confirmed | WBPerson499 | ||||||
WBPhenotype:0002462 | Paper_evidence | WBPaper00045395 | |||||
Curator_confirmed | WBPerson499 | ||||||
Remark | increased fungal spore adhesion | Paper_evidence | WBPaper00045395 | ||||
Curator_confirmed | WBPerson499 | ||||||
WBPhenotype:0004006 | Paper_evidence | WBPaper00037686 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Hermaphrodites experienced significantly reduced contact times by males during mating. | Paper_evidence | WBPaper00037686 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0000031 | Paper_evidence | WBPaper00037686 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals did not exhibit any conspicuous difference from wild type. | Paper_evidence | WBPaper00037686 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000145 | Paper_evidence | WBPaper00037686 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals did not exhibit any conspicuous differences from wild type. | Paper_evidence | WBPaper00037686 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00037686 | ||||||
WBPaper00045395 | |||||||
Method | Substitution_allele |