WormBase Tree Display for Variation: WBVar00317286
expand all nodes | collapse all nodes | view schema
WBVar00317286 | Name | Public_name | tm5034 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE41376:p.Ser97GlnfsTer2 | |||||||
CE05571:p.Ser64GlnfsTer2 | ||||||||
CE49942:p.Ser31GlnfsTer2 | ||||||||
F08G5.1b.1:c.189_478del | ||||||||
F08G5.1a.1:c.288_577del | ||||||||
F08G5.1c.1:c.90_379del | ||||||||
HGVSg | CHROMOSOME_IV:g.12409316_12409653del | |||||||
Sequence_details | SMap | S_parent | Sequence | F08G5 | ||||
Flanking_sequences | tcttcgtggcgaagatcgggagaattttct | acaataggccagcgtcgagtgccagcactg | ||||||
Mapping_target | F08G5 | |||||||
Source_location | 7 | CHROMOSOME_IV | 12409315 | 12409654 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm5034_external | |||||||
tm5034_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 5034 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00008580 | ||||||
Transcript | F08G5.1b.1 (11) | |||||||
F08G5.1c.1 (11) | ||||||||
F08G5.1a.1 (11) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000052 | Paper_evidence | WBPaper00044131 | ||||
Curator_confirmed | WBPerson136 | |||||||
Remark | Both alleles are complete loss-of-function | Paper_evidence | WBPaper00044131 | |||||
Curator_confirmed | WBPerson136 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00044131 | |||||
Curator_confirmed | WBPerson136 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00044131 | ||||||
Curator_confirmed | WBPerson136 | |||||||
Remark | Absence of meiotic double-strand breaks results in extended transition zone, defective chromosome segregation | Paper_evidence | WBPaper00044131 | |||||
Curator_confirmed | WBPerson136 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00044131 | |||||
Curator_confirmed | WBPerson136 | |||||||
WBPhenotype:0001499 | Paper_evidence | WBPaper00044131 | ||||||
Curator_confirmed | WBPerson136 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00044131 | |||||
Curator_confirmed | WBPerson136 | |||||||
Reference | WBPaper00044131 | |||||||
WBPaper00064961 | ||||||||
Remark | 3074/3075-3412/3413 (338 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |