WormBase Tree Display for Variation: WBVar00317290

WBVar00317290 Name: Public_name: tm5028
    Other_name: F17C8.1.1:c.1456-24_1778del
    HGVSg: CHROMOSOME_III:g.4727398_4727744del
  Sequence_details: SMap: S_parent: Sequence: F17C8
    Flanking_sequences: taccagcctaaaagttttattctgatcgag atcacttcaagcattggcaacgaataattt
    Mapping_target: F17C8
    Source_location: 7 CHROMOSOME_III 4727397 4727745 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5028_external
      tm5028_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5028
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000068
    Transcript: F17C8.1.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F17C8.1.1:c.1456-24_1778del
        cDNA_position: ?-1895
        CDS_position: ?-1778
        Protein_position: ?-593
        Intron_number: 8/14
        Exon_number: 9/15
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 10446/10447-10793/10794 (347 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele