WormBase Tree Display for Variation: WBVar00317321

WBVar00317321 Name: Public_name: tm5058
    HGVSg: CHROMOSOME_V:g.20605058_20605402del
  Sequence_details: SMap: S_parent: Sequence: F46B3
    Flanking_sequences: aaaaaaataggggctcacgtggagtttttt gtaaccgcaaaatttctactagttctttca
    Mapping_target: F46B3
    Source_location: 7 CHROMOSOME_V 20605057 20605403 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5058_external
      tm5058_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5058
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00050892
    Transcript: F46B3.18.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2/5
        Exon_number: 1-2/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 9007/9008-9352/9353 (345 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele