WormBase Tree Display for Variation: WBVar00317352

WBVar00317352 Name: Public_name: tm4536
    Other_name: CE29752:p.Glu91_Ter180del
      F09E5.5.2:c.270_539del
      F09E5.5.1:c.270_539del
    HGVSg: CHROMOSOME_II:g.5359934_5360256del
  Sequence_details: SMap: S_parent: Sequence: F09E5
    Flanking_sequences: agagcgtctcggaccatttccccaactgaa gggagttgactcggttgtcgccgaattgtc
    Mapping_target: F09E5
    Source_location: 7 CHROMOSOME_II 5359933 5360257 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4536_external
      tm4536_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4536
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00017284
    Transcript: F09E5.5.1 (11)
      F09E5.5.2 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 20077/20078-20400/20401 (323 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele