WormBase Tree Display for Variation: WBVar00317377

WBVar00317377 Name: Public_name: tm5131
    Other_name: C36B1.7.1:c.298_*17del
    HGVSg: CHROMOSOME_I:g.8736609_8736940del
  Sequence_details: SMap: S_parent: Sequence: C36B1
    Flanking_sequences: AACTCGCTCGAAGCGGCTATGAAACTACTT CTGTTTATTTTTTTAATTTATATGTATTCA
    Mapping_target: C36B1
    Type_of_mutation: Deletion
    PCR_product: tm5131_external
      tm5131_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5131
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007974
    Transcript: C36B1.7.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C36B1.7.1:c.298_*17del
        cDNA_position: 307-596
        CDS_position: 298-?
        Protein_position: 100-?
        Intron_number: 4/5
        Exon_number: 4-6/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 23173/23174-23503/23504 (330 bp deletion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele