WormBase Tree Display for Variation: WBVar00317413
expand all nodes | collapse all nodes | view schema
WBVar00317413 | Evidence | Paper_evidence | WBPaper00038206 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | u815 | ||||||
Other_name | CE36153:p.Glu381Lys | |||||||
CE36154:p.Glu381Lys | ||||||||
F33E2.2d.1:c.922G>A | ||||||||
CE23702:p.Glu308Lys | ||||||||
F33E2.2c.1:c.1141G>A | ||||||||
CE36155:p.Glu381Lys | ||||||||
F33E2.2a.1:c.1141G>A | ||||||||
F33E2.2b.1:c.1141G>A | ||||||||
HGVSg | CHROMOSOME_I:g.12569694C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F33E2 | ||||
Flanking_sequences | atccgacaacactgggagatcttcaagccg | aacttttcgaaatgactgaagaggagtggc | ||||||
Mapping_target | F33E2 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | TU | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001008 | ||||||
Transcript | F33E2.2a.1 (12) | |||||||
F33E2.2d.1 (12) | ||||||||
F33E2.2b.1 (12) | ||||||||
F33E2.2c.1 (12) | ||||||||
Genetics | Interpolated_map_position | I | 13.6077 | |||||
Description | Phenotype | WBPhenotype:0000487 | Paper_evidence | WBPaper00038206 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | This mutation suppressed the colchicine-dependent reduction in expression of the Praja::GFP reporter. | Paper_evidence | WBPaper00038206 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003637 | Paper_evidence | WBPaper00038206 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | uIs43, uIs44(Pmec-18::praja::gfp) | Paper_evidence | WBPaper00038206 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038206 | |||||||
Method | Substitution_allele |