WormBase Tree Display for Variation: WBVar00317447

WBVar00317447 Name: Public_name: tm5197
    HGVSg: CHROMOSOME_III:g.10747585_10747805del
  Sequence_details: SMap: S_parent: Sequence: K01G5
    Flanking_sequences: gagtggctgaaaacaattattgaactggga aatgcgaattattgcgaaattctacgtatt
    Mapping_target: K01G5
    Source_location: 7 CHROMOSOME_III 10747584 10747806 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5197_external
      tm5197_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5197
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004302
      WBGene00197604
    Transcript: K01G5.4.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2/6
        Exon_number: 1-2/7
      K01G5.12 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-19
        Exon_number: 1/1
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 7035/7036-7256/7257 (221 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele