WormBase Tree Display for Variation: WBVar00317481

WBVar00317481 Name: Public_name: tm4492
    Other_name: ZC395.3b.1:c.540_737delinsC
      ZC395.3a.2:c.486_683delinsC
      ZC395.3a.1:c.486_683delinsC
      CE01439:p.Val181MetfsTer34
      CE15207:p.Val163MetfsTer34
    HGVSg: CHROMOSOME_III:g.5276025_5276345delinsC
  Sequence_details: SMap: S_parent: Sequence: ZC395
    Flanking_sequences: atacgctcttaaaaatcaaccgtttcaaca atgctgtctgctgctctctgttgctgtgtt
    Mapping_target: ZC395
    Source_location: 7 CHROMOSOME_III 5276024 5276346 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: C
      Deletion
    PCR_product: tm4492_external
      tm4492_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4492
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006590
    Transcript: ZC395.3a.2 (11)
      ZC395.3a.1 (11)
      ZC395.3b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 12436/12437-C-12757/12758 (321 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele