WormBase Tree Display for Variation: WBVar00531936
expand all nodes | collapse all nodes | view schema
| WBVar00531936 | Evidence | Paper_evidence | WBPaper00038421 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | hj12 | |||||
| Other_name | F53H10.2d.1:c.1114C>T | ||||||
| F53H10.2b.1:c.1171C>T | |||||||
| CE48392:p.Arg372Ter | |||||||
| F53H10.2c.1:c.883C>T | |||||||
| CE32433:p.Arg615Ter | |||||||
| CE41815:p.Arg295Ter | |||||||
| CE41814:p.Arg391Ter | |||||||
| F53H10.2a.1:c.1843C>T | |||||||
| HGVSg | CHROMOSOME_V:g.10854023G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F53H10 | |||
| Flanking_sequences | acatggaaaaaagattgtccagatgattat | gaaaactcagaaatttaagaagaaaacggc | |||||
| Mapping_target | F53H10 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00038421 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00040198 | ||||||
| Laboratory | VS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00010012 | |||||
| Transcript | F53H10.2c.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F53H10.2c.1:c.883C>T | ||||||
| HGVSp | CE41815:p.Arg295Ter | ||||||
| cDNA_position | 883 | ||||||
| CDS_position | 883 | ||||||
| Protein_position | 295 | ||||||
| Exon_number | 5/7 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| F53H10.2b.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F53H10.2b.1:c.1171C>T | ||||||
| HGVSp | CE41814:p.Arg391Ter | ||||||
| cDNA_position | 1171 | ||||||
| CDS_position | 1171 | ||||||
| Protein_position | 391 | ||||||
| Exon_number | 7/9 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| F53H10.2a.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F53H10.2a.1:c.1843C>T | ||||||
| HGVSp | CE32433:p.Arg615Ter | ||||||
| cDNA_position | 1843 | ||||||
| CDS_position | 1843 | ||||||
| Protein_position | 615 | ||||||
| Exon_number | 13/16 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| F53H10.2d.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F53H10.2d.1:c.1114C>T | ||||||
| HGVSp | CE48392:p.Arg372Ter | ||||||
| cDNA_position | 1114 | ||||||
| CDS_position | 1114 | ||||||
| Protein_position | 372 | ||||||
| Exon_number | 6/9 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| Interactor | WBInteraction000501301 | ||||||
| Genetics | Interpolated_map_position | V | 2.82462 | ||||
| Description | Phenotype | WBPhenotype:0000717 | Paper_evidence | WBPaper00038421 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Loss of saeg-1 function did not drastically alter egl-4 mRNA levels and more importantly, endogenous EGL-4 protein level remained constant. Animals carrying the hj11 allele are phenotypically indistinguishable to those carrying the hj12 allele. | Paper_evidence | WBPaper00038421 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Recessive | Paper_evidence | WBPaper00038421 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00038421 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00038421 | ||||||
| Method | Substitution_allele |
