WormBase Tree Display for Variation: WBVar00597539

WBVar00597539 Name: Public_name: tm5233
    Other_name: CE32928:p.Tyr269Ter
      T05H10.1.1:c.807_1410del
    HGVSg: CHROMOSOME_II:g.8043441_8044091del
  Sequence_details: SMap: S_parent: Sequence: T05H10
    Flanking_sequences: accagaacttcttgatggatcaaaccaata atgtatcgcagggtaagtttttgaaagata
    Mapping_target: T05H10
    Source_location: 7 CHROMOSOME_II 8043440 8044092 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5233_external
      tm5233_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5233
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00011507
    Transcript: T05H10.1.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 1095/1096-1746/1747 (651 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele