WormBase Tree Display for Variation: WBVar00597548

WBVar00597548 Name: Public_name: tm5209
    Other_name: D1005.1.1:c.-10_853del
    HGVSg: CHROMOSOME_X:g.1479562_1480674del
  Sequence_details: SMap: S_parent: Sequence: D1005
    Flanking_sequences: tttctttcaggtaactcgttctctttggaa gagtttggacgatggtggctggtggtggag
    Mapping_target: D1005
    Source_location: 7 CHROMOSOME_X 1479561 1480675 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5209_external
      tm5209_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5209
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016995
    Transcript: D1005.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: D1005.1.1:c.-10_853del
        cDNA_position: 21-883
        CDS_position: ?-853
        Protein_position: ?-285
        Intron_number: 2-3/8
        Exon_number: 1-4/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 26809/26810-27922/27923 (1113 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele