WormBase Tree Display for Variation: WBVar00597553

WBVar00597553 Name: Public_name: tm5259
    Other_name: C06A5.3a.1:c.458+105_753del
      C06A5.3b.1:c.458+105_753del
    HGVSg: CHROMOSOME_I:g.5987188_5987645del
  Sequence_details: SMap: S_parent: Sequence: C06A5
    Flanking_sequences: ttcaaactttaaaaaaatgtttctcgctgt tttgatgatctttttggtcgatcccgaaat
    Mapping_target: C06A5
    Source_location: 7 CHROMOSOME_I 5987187 5987646 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5259_external
      tm5259_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5259
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015501
    Transcript: C06A5.3a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C06A5.3a.1:c.458+105_753del
        cDNA_position: ?-761
        CDS_position: ?-753
        Protein_position: ?-251
        Intron_number: 3/10
        Exon_number: 4/11
      C06A5.3b.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C06A5.3b.1:c.458+105_753del
        cDNA_position: ?-765
        CDS_position: ?-753
        Protein_position: ?-251
        Intron_number: 3/10
        Exon_number: 4/11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 7091/7092-7549/7550 (458 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele